Transcript: Mouse NM_026516.2

Mus musculus transmembrane protein 178 (Tmem178), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Tmem178 (68027)
Length:
1696
CDS:
58..951

Additional Resources:

NCBI RefSeq record:
NM_026516.2
NBCI Gene record:
Tmem178 (68027)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026516.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216733 GCATCGCTTATCCGTTTATTA pLKO.1 881 CDS 100% 15.000 21.000 N Tmem178 n/a
2 TRCN0000181453 CTATTCCTCATGACAGGGATA pLKO.1 694 CDS 100% 4.050 5.670 N Tmem178 n/a
3 TRCN0000172395 CACCCTCATCCTGAAAGGTAT pLKO.1 441 CDS 100% 4.950 3.960 N TMEM178A n/a
4 TRCN0000217583 GAATTGCACTGCAGGACATTT pLKO.1 1199 3UTR 100% 13.200 9.240 N Tmem178 n/a
5 TRCN0000215489 GACGAAGATTGCACATCTAAA pLKO.1 906 CDS 100% 13.200 9.240 N Tmem178 n/a
6 TRCN0000177922 CCAATCCGCTTAAGAAACATT pLKO.1 502 CDS 100% 5.625 3.938 N Tmem178 n/a
7 TRCN0000178698 CCTGCTTCATCTAAGAAGAAT pLKO.1 564 CDS 100% 5.625 3.938 N Tmem178 n/a
8 TRCN0000198604 CAGTGTCTCCTATGACTTGAA pLKO.1 747 CDS 100% 4.950 3.465 N Tmem178 n/a
9 TRCN0000200431 GCGATGCACAGCAATCAAGTA pLKO.1 468 CDS 100% 4.950 3.465 N Tmem178 n/a
10 TRCN0000177768 CGTTTCTATTTGCAAGAGGAT pLKO.1 1312 3UTR 100% 2.640 1.848 N Tmem178 n/a
11 TRCN0000182675 GAAGTGCTACTTTCTGGGCAT pLKO.1 405 CDS 100% 2.160 1.512 N Tmem178 n/a
12 TRCN0000198791 CACAGCAATCAAGTACCACTT pLKO.1 474 CDS 100% 4.050 2.430 N Tmem178 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026516.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.