Transcript: Mouse NM_026566.2

Mus musculus autophagy related 101 (Atg101), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Atg101 (68118)
Length:
1230
CDS:
312..968

Additional Resources:

NCBI RefSeq record:
NM_026566.2
NBCI Gene record:
Atg101 (68118)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026566.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000190053 GCCTTAATGGCAGCTCCTTAA pLKO.1 980 3UTR 100% 10.800 8.640 N Atg101 n/a
2 TRCN0000277213 ACCATGCGCAGGCTCATCAAA pLKO_005 930 CDS 100% 5.625 4.500 N Atg101 n/a
3 TRCN0000191048 CTACAAGATCTCCTTTCAGAT pLKO.1 878 CDS 100% 4.950 3.960 N Atg101 n/a
4 TRCN0000277212 CTACAAGATCTCCTTTCAGAT pLKO_005 878 CDS 100% 4.950 3.960 N Atg101 n/a
5 TRCN0000201201 GACTTCATCGACTTCACCTAT pLKO.1 483 CDS 100% 4.950 3.960 N Atg101 n/a
6 TRCN0000192759 CCTTAATGGCAGCTCCTTAAT pLKO.1 981 3UTR 100% 13.200 9.240 N Atg101 n/a
7 TRCN0000277215 CCTTAATGGCAGCTCCTTAAT pLKO_005 981 3UTR 100% 13.200 9.240 N Atg101 n/a
8 TRCN0000328879 GCTGTGCGAGAAGATCATTAA pLKO_005 752 CDS 100% 13.200 9.240 N Atg101 n/a
9 TRCN0000277153 ACGGGCAAGTTTCACTACAAG pLKO_005 411 CDS 100% 4.950 3.465 N Atg101 n/a
10 TRCN0000201936 CGGGCAAGTTTCACTACAAGA pLKO.1 412 CDS 100% 4.950 3.465 N Atg101 n/a
11 TRCN0000192291 CATTAACATCGTGGAGGTGAT pLKO.1 767 CDS 100% 4.050 2.835 N Atg101 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026566.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03896 pDONR223 100% 91.1% 98.6% None (many diffs) n/a
Download CSV