Transcript: Mouse NM_026614.2

Mus musculus NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5 (Ndufa5), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Ndufa5 (68202)
Length:
549
CDS:
142..492

Additional Resources:

NCBI RefSeq record:
NM_026614.2
NBCI Gene record:
Ndufa5 (68202)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026614.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041819 CGAGAGGCTCACAATATTGTA pLKO.1 204 CDS 100% 5.625 4.500 N Ndufa5 n/a
2 TRCN0000287832 CGAGAGGCTCACAATATTGTA pLKO_005 204 CDS 100% 5.625 4.500 N Ndufa5 n/a
3 TRCN0000295282 CAAGGCGGAGCCAGATGTTAA pLKO_005 318 CDS 100% 13.200 9.240 N Ndufa5 n/a
4 TRCN0000295283 ACCAACGAGAAGCTGGATATG pLKO_005 295 CDS 100% 10.800 7.560 N Ndufa5 n/a
5 TRCN0000041818 AGGTGATTCTTCAGGCTGAAA pLKO.1 377 CDS 100% 4.950 3.465 N Ndufa5 n/a
6 TRCN0000026449 GAGGTGATTCTTCAGGCTGAA pLKO.1 376 CDS 100% 4.050 2.835 N NDUFA5 n/a
7 TRCN0000041821 CTTTCCTAAACATGCAGCCTA pLKO.1 252 CDS 100% 2.640 1.848 N Ndufa5 n/a
8 TRCN0000041820 GCCTTGCTTCAGGGTGGTGAA pLKO.1 349 CDS 100% 1.350 0.945 N Ndufa5 n/a
9 TRCN0000287834 GCCTTGCTTCAGGGTGGTGAA pLKO_005 349 CDS 100% 1.350 0.945 N Ndufa5 n/a
10 TRCN0000041822 GAAGTGGAAGAGGTGATTCTT pLKO.1 367 CDS 100% 5.625 3.375 N Ndufa5 n/a
11 TRCN0000287763 GAAGTGGAAGAGGTGATTCTT pLKO_005 367 CDS 100% 5.625 3.375 N Ndufa5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026614.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.