Transcript: Mouse NM_026617.3

Mus musculus transmembrane BAX inhibitor motif containing 4 (Tmbim4), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Tmbim4 (68212)
Length:
808
CDS:
21..737

Additional Resources:

NCBI RefSeq record:
NM_026617.3
NBCI Gene record:
Tmbim4 (68212)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026617.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000307607 CTGGTTCTGCAAGCGTTTATA pLKO_005 387 CDS 100% 15.000 12.000 N Tmbim4 n/a
2 TRCN0000306896 CGCATCCTCTGAACCTCTATC pLKO_005 298 CDS 100% 10.800 8.640 N Tmbim4 n/a
3 TRCN0000126509 CCTGCCTTAATTGTGGTGTTT pLKO.1 228 CDS 100% 4.950 3.960 N Tmbim4 n/a
4 TRCN0000295644 TGTTACCTTCTATGATGTATA pLKO_005 365 CDS 100% 13.200 9.240 N Tmbim4 n/a
5 TRCN0000126511 CCTATACTCTACAATCAAAGA pLKO.1 439 CDS 100% 4.950 3.465 N Tmbim4 n/a
6 TRCN0000288308 CCTATACTCTACAATCAAAGA pLKO_005 439 CDS 100% 4.950 3.465 N Tmbim4 n/a
7 TRCN0000126510 CTCTACAATCAAAGAGAGATT pLKO.1 445 CDS 100% 4.950 3.465 N Tmbim4 n/a
8 TRCN0000126512 CTGCGGACATTTGTCCATGAA pLKO.1 204 CDS 100% 4.950 3.465 N Tmbim4 n/a
9 TRCN0000126513 GCCTTAATTGTGGTGTTTGCT pLKO.1 231 CDS 100% 3.000 2.100 N Tmbim4 n/a
10 TRCN0000288309 GCCTTAATTGTGGTGTTTGCT pLKO_005 231 CDS 100% 3.000 2.100 N Tmbim4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026617.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.