Transcript: Mouse NM_026768.3

Mus musculus mitochondrial ribosomal protein S18A (Mrps18a), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Mrps18a (68565)
Length:
864
CDS:
15..605

Additional Resources:

NCBI RefSeq record:
NM_026768.3
NBCI Gene record:
Mrps18a (68565)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026768.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098796 CGAGCAGGTCTGTTACCAAAT pLKO.1 384 CDS 100% 10.800 8.640 N Mrps18a n/a
2 TRCN0000098799 CACAAATATACCTATGAGGAT pLKO.1 249 CDS 100% 2.640 2.112 N Mrps18a n/a
3 TRCN0000098797 CGACTGTAATTGAAGGCCGAA pLKO.1 151 CDS 100% 2.160 1.728 N Mrps18a n/a
4 TRCN0000304805 TCCGTCAAGCCCATCTATAAA pLKO_005 486 CDS 100% 15.000 10.500 N Mrps18a n/a
5 TRCN0000304804 CCTCCCACCAGAACCATTATC pLKO_005 660 3UTR 100% 13.200 9.240 N Mrps18a n/a
6 TRCN0000304803 AGTCAGTTCATCCGGCCTTAT pLKO_005 282 CDS 100% 10.800 7.560 N Mrps18a n/a
7 TRCN0000304862 GCCTCTGAAGATGATGCATTA pLKO_005 584 CDS 100% 10.800 7.560 N Mrps18a n/a
8 TRCN0000098798 CCTGAAAGACAATGTCTGCTA pLKO.1 554 CDS 100% 2.640 1.848 N Mrps18a n/a
9 TRCN0000316281 CCTGAAAGACAATGTCTGCTA pLKO_005 554 CDS 100% 2.640 1.848 N Mrps18a n/a
10 TRCN0000098795 GCTGACTAGAACCGTCTAGAA pLKO.1 627 3UTR 100% 0.495 0.347 N Mrps18a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026768.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.