Transcript: Mouse NM_026842.4

Mus musculus ubiquilin 1 (Ubqln1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ubqln1 (56085)
Length:
3693
CDS:
218..1966

Additional Resources:

NCBI RefSeq record:
NM_026842.4
NBCI Gene record:
Ubqln1 (56085)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026842.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000087733 CGGTTCTAATTGCCATATAAA pLKO.1 2825 3UTR 100% 15.000 21.000 N Ubqln1 n/a
2 TRCN0000327521 CGGTTCTAATTGCCATATAAA pLKO_005 2825 3UTR 100% 15.000 21.000 N Ubqln1 n/a
3 TRCN0000429289 GACCAACTTGTGTTGATATTT pLKO_005 410 CDS 100% 15.000 21.000 N UBQLN1 n/a
4 TRCN0000087734 GCACTGCACCTAGTGAAGATA pLKO.1 1707 CDS 100% 5.625 4.500 N Ubqln1 n/a
5 TRCN0000327522 GCACTGCACCTAGTGAAGATA pLKO_005 1707 CDS 100% 5.625 4.500 N Ubqln1 n/a
6 TRCN0000087737 ACATCAATGCAGCAATCGAAA pLKO.1 1920 CDS 100% 4.950 3.465 N Ubqln1 n/a
7 TRCN0000327602 ACATCAATGCAGCAATCGAAA pLKO_005 1920 CDS 100% 4.950 3.465 N Ubqln1 n/a
8 TRCN0000004375 CTCCCAACTTTCCTCCAACAA pLKO.1 1511 CDS 100% 4.950 3.465 N UBQLN1 n/a
9 TRCN0000087736 GCAGAGTCCAGAAGTCAGATT pLKO.1 1816 CDS 100% 4.950 3.465 N Ubqln1 n/a
10 TRCN0000327601 GCAGAGTCCAGAAGTCAGATT pLKO_005 1816 CDS 100% 4.950 3.465 N Ubqln1 n/a
11 TRCN0000087735 CCAGAAGTCAGATTTCAGCAA pLKO.1 1823 CDS 100% 2.640 1.848 N Ubqln1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026842.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.