Transcript: Mouse NM_026896.5

Mus musculus mediator complex subunit 27 (Med27), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Med27 (68975)
Length:
1276
CDS:
36..971

Additional Resources:

NCBI RefSeq record:
NM_026896.5
NBCI Gene record:
Med27 (68975)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026896.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096043 CCTCAATGAACTGGAACGTTT pLKO.1 233 CDS 100% 4.950 6.930 N Med27 n/a
2 TRCN0000324381 CCTCAATGAACTGGAACGTTT pLKO_005 233 CDS 100% 4.950 6.930 N Med27 n/a
3 TRCN0000096040 GCCCTGCTTCACTATCAGTTA pLKO.1 780 CDS 100% 4.950 6.930 N Med27 n/a
4 TRCN0000324380 GCCCTGCTTCACTATCAGTTA pLKO_005 780 CDS 100% 4.950 6.930 N Med27 n/a
5 TRCN0000096042 CCATTCACTTATCGAGACCCA pLKO.1 565 CDS 100% 0.660 0.528 N Med27 n/a
6 TRCN0000324449 CCATTCACTTATCGAGACCCA pLKO_005 565 CDS 100% 0.660 0.528 N Med27 n/a
7 TRCN0000096039 CATTCACCACACAGGAGTCTA pLKO.1 1035 3UTR 100% 4.950 3.465 N Med27 n/a
8 TRCN0000324379 CATTCACCACACAGGAGTCTA pLKO_005 1035 3UTR 100% 4.950 3.465 N Med27 n/a
9 TRCN0000096041 CCTGGCTGAGAAGCTACATTA pLKO.1 838 CDS 100% 13.200 7.920 N Med27 n/a
10 TRCN0000324453 CCTGGCTGAGAAGCTACATTA pLKO_005 838 CDS 100% 13.200 7.920 N Med27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026896.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.