Transcript: Mouse NM_026994.1

Mus musculus crystallin, zeta (quinone reductase)-like 1 (Cryzl1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Cryzl1 (66609)
Length:
1747
CDS:
252..1253

Additional Resources:

NCBI RefSeq record:
NM_026994.1
NBCI Gene record:
Cryzl1 (66609)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026994.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313428 CAGTAAGATGTTTGGTTATTT pLKO_005 1381 3UTR 100% 15.000 12.000 N Cryzl1 n/a
2 TRCN0000230361 GGTGGCCTGGGAGTAGATATT pLKO_005 846 CDS 100% 13.200 9.240 N CRYZL1 n/a
3 TRCN0000349945 GGTGGCCTGGGAGTAGATATT pLKO_005 846 CDS 100% 13.200 9.240 N Cryzl1 n/a
4 TRCN0000313427 GAGCATTACCTGGTTCATAAG pLKO_005 525 CDS 100% 10.800 7.560 N Cryzl1 n/a
5 TRCN0000042127 CCTGTCACAGAGGATAACTTT pLKO.1 327 CDS 100% 5.625 3.938 N Cryzl1 n/a
6 TRCN0000042123 CCACAGTAAGATGTTTGGTTA pLKO.1 1378 3UTR 100% 4.950 3.465 N Cryzl1 n/a
7 TRCN0000042124 CCCGTGTGATTGATGTGTCTA pLKO.1 784 CDS 100% 4.950 3.465 N Cryzl1 n/a
8 TRCN0000312384 CCCGTGTGATTGATGTGTCTA pLKO_005 784 CDS 100% 4.950 3.465 N Cryzl1 n/a
9 TRCN0000042125 GCTCTGTATTATCTTTCTCAA pLKO.1 609 CDS 100% 4.950 3.465 N Cryzl1 n/a
10 TRCN0000312383 GCTCTGTATTATCTTTCTCAA pLKO_005 609 CDS 100% 4.950 3.465 N Cryzl1 n/a
11 TRCN0000042126 CCACTGTATGAGGCAAAGGTT pLKO.1 1176 CDS 100% 3.000 2.100 N Cryzl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026994.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.