Transcript: Mouse NM_027112.1

Mus musculus calpain, small subunit 2 (Capns2), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Capns2 (69543)
Length:
1015
CDS:
91..834

Additional Resources:

NCBI RefSeq record:
NM_027112.1
NBCI Gene record:
Capns2 (69543)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027112.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239901 TCAGGTGTCCATCCGAGAATG pLKO_005 789 CDS 100% 10.800 8.640 N Capns2 n/a
2 TRCN0000239900 CCAGCTCAATGAGCAACTTTA pLKO_005 636 CDS 100% 13.200 9.240 N Capns2 n/a
3 TRCN0000239899 GTGCTACTGACCTGATGAATA pLKO_005 374 CDS 100% 13.200 9.240 N Capns2 n/a
4 TRCN0000239898 TGGATGCAGAGAGGTAGAGAC pLKO_005 837 3UTR 100% 4.050 2.430 N Capns2 n/a
5 TRCN0000239897 ACTGGGATTTGAGGAATTTAA pLKO_005 501 CDS 100% 15.000 7.500 Y Capns2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027112.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04360 pDONR223 100% 85.9% 91.9% None (many diffs) n/a
2 ccsbBroad304_04360 pLX_304 0% 85.9% 91.9% V5 (many diffs) n/a
3 TRCN0000468908 TCCGCGGTTCAGGCTATTGAACCA pLX_317 59.8% 85.9% 91.9% V5 (many diffs) n/a
Download CSV