Transcript: Mouse NM_027123.5

Mus musculus FAST kinase domains 3 (Fastkd3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Fastkd3 (69577)
Length:
2476
CDS:
165..2150

Additional Resources:

NCBI RefSeq record:
NM_027123.5
NBCI Gene record:
Fastkd3 (69577)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027123.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417408 GCAAGGTAAAGAGTCATATTT pLKO_005 1601 CDS 100% 15.000 21.000 N Fastkd3 n/a
2 TRCN0000200149 CAAAGGTGTTGACGCCCTATT pLKO.1 1834 CDS 100% 10.800 15.120 N Fastkd3 n/a
3 TRCN0000177943 GATTCCATCACGCATACTGTA pLKO.1 331 CDS 100% 4.950 6.930 N Fastkd3 n/a
4 TRCN0000422215 CTCCGCTGTCCACTGGTAATA pLKO_005 2132 CDS 100% 13.200 9.240 N Fastkd3 n/a
5 TRCN0000423914 ATGTGCTCTGTGCCCGTTTAC pLKO_005 1468 CDS 100% 10.800 7.560 N Fastkd3 n/a
6 TRCN0000416778 TAGTCAGATTGCCGAGCTAAT pLKO_005 1382 CDS 100% 10.800 7.560 N Fastkd3 n/a
7 TRCN0000178359 GAGCCATTTGGAAAGCTCAAT pLKO.1 1404 CDS 100% 4.950 3.465 N Fastkd3 n/a
8 TRCN0000177402 GCTTACATCAAGACTTGAGTT pLKO.1 2075 CDS 100% 4.950 3.465 N Fastkd3 n/a
9 TRCN0000182677 GCTGAGTTTCATAAGTGCCCT pLKO.1 509 CDS 100% 0.660 0.462 N Fastkd3 n/a
10 TRCN0000429804 AGCCACTCTATGGAAATTATG pLKO_005 2224 3UTR 100% 13.200 7.920 N Fastkd3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027123.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.