Transcript: Mouse NM_027184.2

Mus musculus inositol polyphosphate multikinase (Ipmk), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Ipmk (69718)
Length:
5462
CDS:
189..1379

Additional Resources:

NCBI RefSeq record:
NM_027184.2
NBCI Gene record:
Ipmk (69718)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027184.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360808 GATGCGATTGCCGCCAGTATT pLKO_005 807 CDS 100% 13.200 18.480 N Ipmk n/a
2 TRCN0000360732 ACCAAACGATGTGTACCTAAA pLKO_005 503 CDS 100% 10.800 15.120 N Ipmk n/a
3 TRCN0000024842 CACCAAACGATGTGTACCTAA pLKO.1 502 CDS 100% 4.950 6.930 N Ipmk n/a
4 TRCN0000024841 ACCCTGTATAATGGACGTGAA pLKO.1 554 CDS 100% 4.050 5.670 N Ipmk n/a
5 TRCN0000024839 CCTAACGAAAGAGACCCTGAA pLKO.1 740 CDS 100% 4.050 5.670 N Ipmk n/a
6 TRCN0000360807 GAGGCTCTGTGGGTTCTATAT pLKO_005 1805 3UTR 100% 13.200 9.240 N Ipmk n/a
7 TRCN0000360733 TTGCCGTGCTTCGGAGTATTT pLKO_005 1348 CDS 100% 13.200 9.240 N Ipmk n/a
8 TRCN0000024840 CCCAGATGGTACAGTTCTGAA pLKO.1 341 CDS 100% 4.950 3.465 N Ipmk n/a
9 TRCN0000024843 CGGCAAGGACAAAGTGGGCAT pLKO.1 311 CDS 100% 0.720 0.504 N Ipmk n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027184.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.