Transcript: Mouse NM_027185.3

Mus musculus differentially expressed in FDCP 6 (Def6), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Def6 (23853)
Length:
2294
CDS:
66..1958

Additional Resources:

NCBI RefSeq record:
NM_027185.3
NBCI Gene record:
Def6 (23853)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027185.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100165 TGGAGGCTGTTTGAGATATTA pLKO.1 2103 3UTR 100% 15.000 10.500 N Def6 n/a
2 TRCN0000100169 AGCGAACAGAAGTCCCTCAAT pLKO.1 1866 CDS 100% 4.950 3.465 N Def6 n/a
3 TRCN0000100166 GCCCTACCTCAACAAGTACAT pLKO.1 272 CDS 100% 4.950 3.465 N Def6 n/a
4 TRCN0000100167 GCTCTGCAACTAGAGGTGAAA pLKO.1 1386 CDS 100% 4.950 3.465 N Def6 n/a
5 TRCN0000100168 GTTCCCGATGAGGTAGAGTAT pLKO.1 477 CDS 100% 4.950 3.465 N Def6 n/a
6 TRCN0000053584 CTCTGCTACTTTGGGAGTGAA pLKO.1 798 CDS 100% 4.950 3.465 N DEF6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027185.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11924 pDONR223 100% 47.4% 49.8% None (many diffs) n/a
2 ccsbBroad304_11924 pLX_304 0% 47.4% 49.8% V5 (many diffs) n/a
Download CSV