Transcript: Mouse NM_027195.2

Mus musculus castor zinc finger 1 (Casz1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Casz1 (69743)
Length:
4428
CDS:
357..3857

Additional Resources:

NCBI RefSeq record:
NM_027195.2
NBCI Gene record:
Casz1 (69743)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027195.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238975 ACGGATTGCCCACAGATAAAC pLKO_005 1696 CDS 100% 13.200 18.480 N Casz1 n/a
2 TRCN0000238974 GCAGGATGTGATCCGACATTA pLKO_005 1868 CDS 100% 13.200 18.480 N Casz1 n/a
3 TRCN0000238976 TGATCGAGAAATGGGTCAATG pLKO_005 616 CDS 100% 10.800 8.640 N Casz1 n/a
4 TRCN0000244256 CAAGTACGAGGAGTGCAAATA pLKO_005 2300 CDS 100% 13.200 9.240 N Casz1 n/a
5 TRCN0000238977 ATACCCAGGCTGAGTCAATAG pLKO_005 4178 3UTR 100% 10.800 7.560 N Casz1 n/a
6 TRCN0000131029 CGAGTACCTGAAGTCAACCTT pLKO.1 1628 CDS 100% 3.000 2.100 N CASZ1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027195.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.