Transcript: Mouse NM_027268.2

Mus musculus secernin 1 (Scrn1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Scrn1 (69938)
Length:
1777
CDS:
145..1389

Additional Resources:

NCBI RefSeq record:
NM_027268.2
NBCI Gene record:
Scrn1 (69938)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027268.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113245 CGACTAAATTACCAGCAGATA pLKO.1 1426 3UTR 100% 4.950 6.930 N Scrn1 n/a
2 TRCN0000113246 GCAGACGATGATTAACATCTT pLKO.1 897 CDS 100% 4.950 3.960 N Scrn1 n/a
3 TRCN0000113247 GCACGGACAAGGTGGAAATTA pLKO.1 552 CDS 100% 15.000 10.500 N Scrn1 n/a
4 TRCN0000113249 CCAGTGGTGTTTGCATAGATT pLKO.1 929 CDS 100% 5.625 3.938 N Scrn1 n/a
5 TRCN0000113248 GCCCTAGACATCATTGTTTCT pLKO.1 520 CDS 100% 4.950 3.465 N Scrn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027268.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07490 pDONR223 100% 86.5% 87.6% None (many diffs) n/a
2 ccsbBroad304_07490 pLX_304 0% 86.5% 87.6% V5 (many diffs) n/a
Download CSV