Transcript: Mouse NM_027347.3

Mus musculus mediator complex subunit 23 (Med23), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Med23 (70208)
Length:
4928
CDS:
114..4226

Additional Resources:

NCBI RefSeq record:
NM_027347.3
NBCI Gene record:
Med23 (70208)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027347.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000341925 ATGTACTGGAGCAACCTTATT pLKO_005 937 CDS 100% 13.200 18.480 N Med23 n/a
2 TRCN0000215781 CTTATATCTTAGAACGAAATG pLKO.1 625 CDS 100% 10.800 15.120 N Med23 n/a
3 TRCN0000217484 GAGACCTTCTCAAAGCGATTT pLKO.1 526 CDS 100% 10.800 15.120 N Med23 n/a
4 TRCN0000217356 GTGGAAACTTACAGCCGTTTA pLKO.1 1812 CDS 100% 10.800 15.120 N Med23 n/a
5 TRCN0000179161 GCCATCTGTAACTCATGGAAA pLKO.1 828 CDS 100% 4.950 6.930 N Med23 n/a
6 TRCN0000341853 GCCATCTGTAACTCATGGAAA pLKO_005 828 CDS 100% 4.950 6.930 N Med23 n/a
7 TRCN0000179866 CCACAAGAAATATCCCGAGAA pLKO.1 2894 CDS 100% 4.050 3.240 N Med23 n/a
8 TRCN0000341854 CCACAAGAAATATCCCGAGAA pLKO_005 2894 CDS 100% 4.050 3.240 N Med23 n/a
9 TRCN0000019195 CCCAGGTTTGTTATTTCATAA pLKO.1 2758 CDS 100% 13.200 9.240 N MED23 n/a
10 TRCN0000178858 CCACCATGTTCAGATTGGTTT pLKO.1 4305 3UTR 100% 4.950 3.465 N Med23 n/a
11 TRCN0000341924 CCACCATGTTCAGATTGGTTT pLKO_005 4305 3UTR 100% 4.950 3.465 N Med23 n/a
12 TRCN0000196182 GCCACCATGTTCAGATTGGTT pLKO.1 4304 3UTR 100% 3.000 2.100 N Med23 n/a
13 TRCN0000183311 GCCTTAACATTTAAGCTGGTT pLKO.1 468 CDS 100% 2.640 1.848 N Med23 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027347.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.