Transcript: Mouse NM_027357.2

Mus musculus proteasome (prosome, macropain) 26S subunit, non-ATPase, 1 (Psmd1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Psmd1 (70247)
Length:
3256
CDS:
172..3033

Additional Resources:

NCBI RefSeq record:
NM_027357.2
NBCI Gene record:
Psmd1 (70247)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027357.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216629 GCAGTTCCTAATACGAAATAA pLKO.1 1188 CDS 100% 15.000 21.000 N Psmd1 n/a
2 TRCN0000254130 GCAGTTCCTAATACGAAATAA pLKO_005 1188 CDS 100% 15.000 21.000 N Psmd1 n/a
3 TRCN0000254128 GGATAATCCAGCACGAGTTAT pLKO_005 2805 CDS 100% 13.200 18.480 N Psmd1 n/a
4 TRCN0000216479 GAATATGTGGAGACTATTATA pLKO.1 454 CDS 100% 15.000 12.000 N Psmd1 n/a
5 TRCN0000254131 TGAATATGTGGAGACTATTAT pLKO_005 453 CDS 100% 15.000 10.500 N Psmd1 n/a
6 TRCN0000254129 TCTCGATGATCACAAGTATAA pLKO_005 594 CDS 100% 13.200 9.240 N Psmd1 n/a
7 TRCN0000265484 TGTCCTGGCGCACACTGAAAT pLKO_005 3068 3UTR 100% 13.200 9.240 N Psmd1 n/a
8 TRCN0000200547 CCAGTTTCTTAGAGATAACTT pLKO.1 1320 CDS 100% 5.625 3.938 N Psmd1 n/a
9 TRCN0000217187 CAAGAATGCCAGCAATGATAT pLKO.1 1566 CDS 100% 13.200 7.920 N Psmd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027357.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.