Transcript: Mouse NM_027375.2

Mus musculus GRIP and coiled-coil domain containing 2 (Gcc2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Gcc2 (70297)
Length:
6528
CDS:
41..5083

Additional Resources:

NCBI RefSeq record:
NM_027375.2
NBCI Gene record:
Gcc2 (70297)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027375.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099950 GCCGTGTTTATTAAAGGATTA pLKO.1 5487 3UTR 100% 10.800 15.120 N Gcc2 n/a
2 TRCN0000099953 CCCTACAAGAAGAAATAACTT pLKO.1 3612 CDS 100% 5.625 7.875 N Gcc2 n/a
3 TRCN0000099952 GCCAGTATGAAAGACTAACTT pLKO.1 3192 CDS 100% 5.625 7.875 N Gcc2 n/a
4 TRCN0000099951 CGGAACAAACAGTATGTGATA pLKO.1 1002 CDS 100% 4.950 6.930 N Gcc2 n/a
5 TRCN0000099954 CGCTATCCTTATGGAGCAAAT pLKO.1 4786 CDS 100% 10.800 8.640 N Gcc2 n/a
6 TRCN0000147313 GCAAGAATTAGAGCTGGTTAA pLKO.1 3442 CDS 100% 10.800 8.640 N GCC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027375.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.