Transcript: Mouse NM_027420.4

Mus musculus actin-related protein 2/3 complex inhibitor (Arpin), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Arpin (70420)
Length:
2184
CDS:
21..701

Additional Resources:

NCBI RefSeq record:
NM_027420.4
NBCI Gene record:
Arpin (70420)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027420.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193016 GCGCTACTATGTGCTGTATAT pLKO.1 191 CDS 100% 13.200 10.560 N Arpin n/a
2 TRCN0000200632 CTTCCTCATGTCATCTTACAA pLKO.1 302 CDS 100% 5.625 3.938 N Arpin n/a
3 TRCN0000190795 GCCCAGTAATGGCATTACCTA pLKO.1 1438 3UTR 100% 3.000 2.100 N Arpin n/a
4 TRCN0000191453 CTTCATAGATTCCTTAGCCAA pLKO.1 521 CDS 100% 2.640 1.848 N Arpin n/a
5 TRCN0000200820 GAAATGAAATTGAGCCCAACT pLKO.1 253 CDS 100% 4.050 2.430 N Arpin n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027420.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.