Transcript: Mouse NM_027476.3

Mus musculus zinc finger, DHHC domain containing 24 (Zdhhc24), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Zdhhc24 (70605)
Length:
2562
CDS:
82..936

Additional Resources:

NCBI RefSeq record:
NM_027476.3
NBCI Gene record:
Zdhhc24 (70605)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027476.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193736 CCTATACCTCACTTTGTTGTT pLKO.1 1217 3UTR 100% 4.950 6.930 N Zdhhc24 n/a
2 TRCN0000438463 GCTGTGTGGGCTTCCATAATT pLKO_005 467 CDS 100% 15.000 12.000 N Zdhhc24 n/a
3 TRCN0000446776 GATGGGATCTCTTTCCAGACT pLKO_005 886 CDS 100% 2.640 2.112 N Zdhhc24 n/a
4 TRCN0000444031 CCAGACGTGCTCTAGAGATTA pLKO_005 1362 3UTR 100% 13.200 9.240 N Zdhhc24 n/a
5 TRCN0000437250 CATGCTACTCACAGGCAAAGT pLKO_005 627 CDS 100% 4.950 3.465 N Zdhhc24 n/a
6 TRCN0000174003 CCATCTTTGCTGGGTTCCTAT pLKO.1 1201 3UTR 100% 4.950 3.465 N Zdhhc24 n/a
7 TRCN0000176435 CTGGTAGAAATGTAGACCTTA pLKO.1 1509 3UTR 100% 4.950 3.465 N Zdhhc24 n/a
8 TRCN0000436918 GTGATGTGGGTCTTGTGACTT pLKO_005 911 CDS 100% 4.950 3.465 N Zdhhc24 n/a
9 TRCN0000443881 CCTTCTTTGAACCTGCCCAAT pLKO_005 1057 3UTR 100% 4.050 2.835 N Zdhhc24 n/a
10 TRCN0000173418 GCTGGTAGAAATGTAGACCTT pLKO.1 1508 3UTR 100% 2.640 1.848 N Zdhhc24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027476.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.