Transcript: Mouse NM_027485.4

Mus musculus mediator complex subunit 26 (Med26), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Med26 (70625)
Length:
3040
CDS:
345..2111

Additional Resources:

NCBI RefSeq record:
NM_027485.4
NBCI Gene record:
Med26 (70625)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027485.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271741 TGTTAAACCTGTGCGGTTAAA pLKO_005 1550 CDS 100% 13.200 18.480 N Med26 n/a
2 TRCN0000095815 CGCACCACTTTATGGCTGAAT pLKO.1 1828 CDS 100% 4.950 6.930 N Med26 n/a
3 TRCN0000095818 GCTCATCAATGATGTCCGCAA pLKO.1 509 CDS 100% 2.160 3.024 N Med26 n/a
4 TRCN0000095817 CCTGAAGAATCGCAACGACAT pLKO.1 722 CDS 100% 4.050 3.240 N Med26 n/a
5 TRCN0000095816 GCGCTTGAACATTCTGCCTTA pLKO.1 2075 CDS 100% 4.050 3.240 N Med26 n/a
6 TRCN0000271771 TGAAGACACACAGGGTAATTG pLKO_005 2006 CDS 100% 13.200 9.240 N Med26 n/a
7 TRCN0000271687 ATGGCTGAAATCTATAGTAAG pLKO_005 2274 3UTR 100% 10.800 7.560 N Med26 n/a
8 TRCN0000430237 GAAATGCTGCTACCAGTTTAC pLKO_005 2210 3UTR 100% 10.800 7.560 N MED26 n/a
9 TRCN0000271757 GGCATCGGAGCTCTTACATAC pLKO_005 1201 CDS 100% 10.800 7.560 N Med26 n/a
10 TRCN0000095814 GCTACCAGTTTACTAACGATT pLKO.1 2218 3UTR 100% 4.950 3.465 N Med26 n/a
11 TRCN0000281777 TATCACGAAATGAGATCATAC pLKO_005 1747 CDS 100% 10.800 6.480 N Med26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027485.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15669 pDONR223 0% 82.3% 84.5% None (many diffs) n/a
2 ccsbBroad304_15669 pLX_304 0% 82.3% 84.5% V5 (many diffs) n/a
Download CSV