Transcript: Mouse NM_027504.3

Mus musculus PR domain containing 16 (Prdm16), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Prdm16 (70673)
Length:
8605
CDS:
115..3942

Additional Resources:

NCBI RefSeq record:
NM_027504.3
NBCI Gene record:
Prdm16 (70673)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027504.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020047 CGCCCACAACTTGCTGGTCAA pLKO.1 2352 CDS 100% 1.350 1.890 N PRDM16 n/a
2 TRCN0000020045 CGGTGACGTTGTAAATAATAT pLKO.1 156 CDS 100% 15.000 12.000 N PRDM16 n/a
3 TRCN0000075462 GCACGGTGAAGCCATTCATAT pLKO.1 1283 CDS 100% 13.200 10.560 N Prdm16 n/a
4 TRCN0000020046 CAGGCTAAGAACCAGGCATAT pLKO.1 3793 CDS 100% 10.800 7.560 N PRDM16 n/a
5 TRCN0000075458 GCATGGTATGAAAGAGGAAAT pLKO.1 4265 3UTR 100% 10.800 7.560 N Prdm16 n/a
6 TRCN0000075461 CCACCTTAGATTCTGAGGTTT pLKO.1 3752 CDS 100% 4.950 3.465 N Prdm16 n/a
7 TRCN0000075460 GCTCCTGTCTACATTCCTGAA pLKO.1 322 CDS 100% 4.050 2.835 N Prdm16 n/a
8 TRCN0000075459 CCTTGCATTATGCTAAGCCTT pLKO.1 2672 CDS 100% 2.640 1.848 N Prdm16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027504.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.