Transcript: Mouse NM_027572.1

Mus musculus solute carrier family 22 (organic cation transporter), member 16 (Slc22a16), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Slc22a16 (70840)
Length:
2377
CDS:
108..2057

Additional Resources:

NCBI RefSeq record:
NM_027572.1
NBCI Gene record:
Slc22a16 (70840)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027572.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070297 GCTATGAGTACAGTGGTTATA pLKO.1 445 CDS 100% 13.200 10.560 N Slc22a16 n/a
2 TRCN0000070294 GTTCCGTATTTGCCTTTATTT pLKO.1 1471 CDS 100% 15.000 10.500 N Slc22a16 n/a
3 TRCN0000070296 GCAAGGAGGTTATTCGGAGAA pLKO.1 1237 CDS 100% 4.050 2.835 N Slc22a16 n/a
4 TRCN0000070295 CCTGTATCTGATATGTGCCTA pLKO.1 173 CDS 100% 2.640 1.848 N Slc22a16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027572.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.