Transcript: Mouse NM_027583.3

Mus musculus spermatogenesis associated 16 (Spata16), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Spata16 (70862)
Length:
1811
CDS:
126..1730

Additional Resources:

NCBI RefSeq record:
NM_027583.3
NBCI Gene record:
Spata16 (70862)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027583.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191003 CGCAAGTTTCATTGAGACAAA pLKO.1 806 CDS 100% 4.950 6.930 N Spata16 n/a
2 TRCN0000202201 CCAGCCTATTTCCGAAACCAT pLKO.1 903 CDS 100% 3.000 4.200 N Spata16 n/a
3 TRCN0000428614 GGCCGAAGCTTTCTCGGTTAT pLKO_005 1088 CDS 100% 10.800 8.640 N Spata16 n/a
4 TRCN0000434006 AGCTGGCAACAGTCCCTTATC pLKO_005 1582 CDS 100% 10.800 7.560 N Spata16 n/a
5 TRCN0000438157 GAATTGCTGCAGTCGCTAATG pLKO_005 1629 CDS 100% 10.800 7.560 N Spata16 n/a
6 TRCN0000190654 GAGGCCAAGATAATGGAACTA pLKO.1 414 CDS 100% 4.950 3.465 N Spata16 n/a
7 TRCN0000190120 CCAGCAATATCTGCTGACACT pLKO.1 1265 CDS 100% 0.264 0.185 N Spata16 n/a
8 TRCN0000202349 GCACTCTGTAAGCAAGCTCAT pLKO.1 1025 CDS 100% 4.050 2.430 N Spata16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027583.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.