Transcript: Mouse NM_027650.3

Mus musculus spermatogenesis associated glutamate (E)-rich protein 3 (Speer3), mRNA.

Source:
NCBI, updated 2016-09-15
Taxon:
Mus musculus (mouse)
Gene:
Speer3 (71026)
Length:
1191
CDS:
40..825

Additional Resources:

NCBI RefSeq record:
NM_027650.3
NBCI Gene record:
Speer3 (71026)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027650.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247911 TGTACGTGACCTAAGTGAGAA pLKO_005 198 CDS 100% 4.950 3.465 N Speer3 n/a
2 TRCN0000247912 TGGTGGAGAAGAATCTTATTA pLKO_005 503 CDS 100% 15.000 9.000 N Speer3 n/a
3 TRCN0000247913 ACTTAGAGTTGGAGATAATTG pLKO_005 413 CDS 100% 13.200 7.920 N Speer3 n/a
4 TRCN0000257761 AGGGTGCTGATGGACAATAAT pLKO_005 980 3UTR 100% 15.000 7.500 Y Speer3 n/a
5 TRCN0000247910 CTTCTATTCAAACCTACATAG pLKO_005 474 CDS 100% 10.800 5.400 Y Speer3 n/a
6 TRCN0000179032 CATGTCCTCTGTGAACAACTT pLKO.1 396 CDS 100% 4.950 2.475 Y Speer3 n/a
7 TRCN0000195789 CAAGAGGAGATACAGGCTGTA pLKO.1 932 3UTR 100% 4.050 2.025 Y Speer3 n/a
8 TRCN0000184328 GATCGCCTGATCTCTTTCCAA pLKO.1 292 CDS 100% 3.000 1.500 Y Speer3 n/a
9 TRCN0000434795 AGCTCAAGAAGGAGATAAATT pLKO_005 455 CDS 100% 15.000 7.500 Y Speer4f1 n/a
10 TRCN0000198111 CTCCAGCAAGAGCTGAAATAT pLKO.1 674 CDS 100% 15.000 7.500 Y Speer2 n/a
11 TRCN0000249995 GAGCTCAAGAAGGAGATAAAT pLKO_005 454 CDS 100% 15.000 7.500 Y Speer4b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027650.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.