Transcript: Mouse NM_027656.2

Mus musculus zinc finger and BTB domain containing 46 (Zbtb46), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Zbtb46 (72147)
Length:
2014
CDS:
34..1836

Additional Resources:

NCBI RefSeq record:
NM_027656.2
NBCI Gene record:
Zbtb46 (72147)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027656.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433443 GTGTGTCTTAGTGGATCTTTA pLKO_005 1894 3UTR 100% 13.200 10.560 N Zbtb46 n/a
2 TRCN0000125840 CCGCTACTTTAAGACGCTCTA pLKO.1 192 CDS 100% 4.050 3.240 N Zbtb46 n/a
3 TRCN0000125841 GCTGACGTGCTCGGTGATGAT pLKO.1 1186 CDS 100% 1.650 1.320 N Zbtb46 n/a
4 TRCN0000444406 AGAGCACATGAAGCGACATAC pLKO_005 1407 CDS 100% 10.800 7.560 N Zbtb46 n/a
5 TRCN0000125843 AGGAGGAGAAACCAGCTACTT pLKO.1 1059 CDS 100% 4.950 3.465 N Zbtb46 n/a
6 TRCN0000158031 CCACAGCAAGGACAAGAAGTA pLKO.1 1434 CDS 100% 4.950 2.970 N ZBTB46 n/a
7 TRCN0000125842 GCAAGGTCTTCAAGGCACATA pLKO.1 149 CDS 100% 4.950 2.970 N Zbtb46 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027656.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.