Transcript: Mouse NM_027728.2

Mus musculus enkurin, TRPC channel interacting protein (Enkur), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Enkur (71233)
Length:
1227
CDS:
218..985

Additional Resources:

NCBI RefSeq record:
NM_027728.2
NBCI Gene record:
Enkur (71233)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027728.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267244 ACTGTTTAGAGCAACTATAAA pLKO_005 304 CDS 100% 15.000 21.000 N Enkur n/a
2 TRCN0000283506 CCACATGGCCATCACACTAAA pLKO_005 1012 3UTR 100% 13.200 9.240 N Enkur n/a
3 TRCN0000267243 GCATCACGCCTGAGTACATAT pLKO_005 672 CDS 100% 13.200 9.240 N Enkur n/a
4 TRCN0000267245 GAGACTCTCTGACGAAGAAAG pLKO_005 775 CDS 100% 10.800 7.560 N Enkur n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027728.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14436 pDONR223 100% 83.1% 85.8% None (many diffs) n/a
2 ccsbBroad304_14436 pLX_304 0% 83.1% 85.8% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000465697 CCCGGGGAGAGCGAACGCCGAATC pLX_317 49.3% 83.1% 85.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV