Transcript: Mouse NM_027748.3

Mus musculus TATA-box binding protein associated factor 3 (Taf3), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Taf3 (209361)
Length:
4821
CDS:
210..3008

Additional Resources:

NCBI RefSeq record:
NM_027748.3
NBCI Gene record:
Taf3 (209361)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027748.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215362 CATGAACTAGAAGACTATATT pLKO.1 441 CDS 100% 15.000 21.000 N Taf3 n/a
2 TRCN0000360110 CATGAACTAGAAGACTATATT pLKO_005 441 CDS 100% 15.000 21.000 N TAF3 n/a
3 TRCN0000241608 TATTACCAGTGACAAGTATTA pLKO_005 3240 3UTR 100% 13.200 18.480 N Taf3 n/a
4 TRCN0000241610 CACGACTCCTGAGCACTAAAG pLKO_005 793 CDS 100% 10.800 15.120 N Taf3 n/a
5 TRCN0000241607 CGTTAGAAACAAAGTCGTTTA pLKO_005 994 CDS 100% 10.800 15.120 N Taf3 n/a
6 TRCN0000217617 GAAGATTCTGATCCCTATAAG pLKO.1 1959 CDS 100% 13.200 10.560 N Taf3 n/a
7 TRCN0000241611 TTTCCTCAGCCCGGAAGTAAA pLKO_005 534 CDS 100% 13.200 9.240 N Taf3 n/a
8 TRCN0000241609 GGTGAAGCCTTCCAACTTATG pLKO_005 408 CDS 100% 10.800 7.560 N Taf3 n/a
9 TRCN0000178859 CCTGTGCAGATTGTCTTCATT pLKO.1 3587 3UTR 100% 5.625 3.938 N Taf3 n/a
10 TRCN0000196135 GCCCTCTCGATTTCCTTTCTT pLKO.1 3280 3UTR 100% 5.625 3.938 N Taf3 n/a
11 TRCN0000016611 CCTGTTAGCAAGAACAATGTA pLKO.1 507 CDS 100% 5.625 3.938 N TAF3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027748.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.