Transcript: Mouse NM_027835.3

Mus musculus interferon induced with helicase C domain 1 (Ifih1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Ifih1 (71586)
Length:
5519
CDS:
326..3403

Additional Resources:

NCBI RefSeq record:
NM_027835.3
NBCI Gene record:
Ifih1 (71586)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027835.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103646 CCACAGAATCAGACACAAGTT pLKO.1 1089 CDS 100% 4.950 6.930 N Ifih1 n/a
2 TRCN0000363777 CCACAGAATCAGACACAAGTT pLKO_005 1089 CDS 100% 4.950 6.930 N Ifih1 n/a
3 TRCN0000103648 CCTACAAATCAACGACACGAT pLKO.1 2158 CDS 100% 2.640 3.696 N Ifih1 n/a
4 TRCN0000334961 CCTACAAATCAACGACACGAT pLKO_005 2158 CDS 100% 2.640 3.696 N Ifih1 n/a
5 TRCN0000103645 CCCATGAGGTATTGTCCTAAA pLKO.1 3638 3UTR 100% 10.800 7.560 N Ifih1 n/a
6 TRCN0000335036 CCCATGAGGTATTGTCCTAAA pLKO_005 3638 3UTR 100% 10.800 7.560 N Ifih1 n/a
7 TRCN0000103649 CCTGATCTTGACTACTCAGAA pLKO.1 3356 CDS 100% 4.950 3.465 N Ifih1 n/a
8 TRCN0000335035 CCTGATCTTGACTACTCAGAA pLKO_005 3356 CDS 100% 4.950 3.465 N Ifih1 n/a
9 TRCN0000103647 GCAAAGCAATACAACGACAAT pLKO.1 3002 CDS 100% 4.950 3.465 N Ifih1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027835.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.