Transcript: Mouse NM_027891.4

Mus musculus leucine-rich repeats and WD repeat domain containing 1 (Lrwd1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Lrwd1 (71735)
Length:
2201
CDS:
124..2070

Additional Resources:

NCBI RefSeq record:
NM_027891.4
NBCI Gene record:
Lrwd1 (71735)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027891.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119914 CTCCTACGACAAACGGATCAT pLKO.1 1362 CDS 100% 4.950 6.930 N Lrwd1 n/a
2 TRCN0000339791 CTCCTACGACAAACGGATCAT pLKO_005 1362 CDS 100% 4.950 6.930 N Lrwd1 n/a
3 TRCN0000339793 ACAGGCCTCGTACTCCATAAG pLKO_005 1111 CDS 100% 10.800 8.640 N Lrwd1 n/a
4 TRCN0000119915 AGTGTGTGGATCTATGATGTT pLKO.1 1855 CDS 100% 4.950 3.465 N Lrwd1 n/a
5 TRCN0000119912 CCTGCAGTGTCATAGCAGAAA pLKO.1 954 CDS 100% 4.950 3.465 N Lrwd1 n/a
6 TRCN0000339790 CCTGCAGTGTCATAGCAGAAA pLKO_005 954 CDS 100% 4.950 3.465 N Lrwd1 n/a
7 TRCN0000165376 GATGGGCTGGCATTTGTGAAT pLKO.1 1630 CDS 100% 4.950 3.465 N LRWD1 n/a
8 TRCN0000119913 GTGTGGATCTATGATGTTGAA pLKO.1 1858 CDS 100% 4.950 3.465 N Lrwd1 n/a
9 TRCN0000339792 GTGTGGATCTATGATGTTGAA pLKO_005 1858 CDS 100% 4.950 3.465 N Lrwd1 n/a
10 TRCN0000119916 GCAGTGTCATAGCAGAAACAA pLKO.1 957 CDS 100% 5.625 3.375 N Lrwd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027891.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.