Transcript: Mouse NM_027930.3

Mus musculus mitochondrial fission regulator 2 (Mtfr2), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Mtfr2 (71804)
Length:
2307
CDS:
93..1178

Additional Resources:

NCBI RefSeq record:
NM_027930.3
NBCI Gene record:
Mtfr2 (71804)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027930.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191182 CGGAGTATTGTTCGTATTATT pLKO.1 246 CDS 100% 15.000 21.000 N Mtfr2 n/a
2 TRCN0000341090 CGGAGTATTGTTCGTATTATT pLKO_005 246 CDS 100% 15.000 21.000 N Mtfr2 n/a
3 TRCN0000341014 TCTACGGAGTCTGATGATTAT pLKO_005 330 CDS 100% 13.200 18.480 N Mtfr2 n/a
4 TRCN0000352470 GTAAATGAAGCTGCAATTAAA pLKO_005 546 CDS 100% 15.000 10.500 N Mtfr2 n/a
5 TRCN0000215713 CCAGTGTCTTTAATATCTAAT pLKO.1 1056 CDS 100% 13.200 9.240 N Mtfr2 n/a
6 TRCN0000217242 CTTCCTTCACCAATGTCTTTC pLKO.1 132 CDS 100% 10.800 7.560 N Mtfr2 n/a
7 TRCN0000341015 TTGTCTCAGATTTCGACATAG pLKO_005 410 CDS 100% 10.800 7.560 N Mtfr2 n/a
8 TRCN0000192762 CCTGGTCTAAGACAGAACAAA pLKO.1 504 CDS 100% 5.625 3.938 N Mtfr2 n/a
9 TRCN0000191943 GAGCAGAAGATGATATTGTTT pLKO.1 1625 3UTR 100% 5.625 3.938 N Mtfr2 n/a
10 TRCN0000341013 GAGCAGAAGATGATATTGTTT pLKO_005 1625 3UTR 100% 5.625 3.938 N Mtfr2 n/a
11 TRCN0000191489 GCATTTCAAGATGATTCCTTT pLKO.1 1095 CDS 100% 4.950 3.465 N Mtfr2 n/a
12 TRCN0000201252 GCCTGTAAATGAAGCTGCAAT pLKO.1 542 CDS 100% 4.950 3.465 N Mtfr2 n/a
13 TRCN0000191418 CATCACATTCTCCAACAGAAA pLKO.1 1179 CDS 100% 4.950 2.970 N Mtfr2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027930.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.