Transcript: Mouse NM_027950.1

Mus musculus oxidative stress induced growth inhibitor 1 (Osgin1), mRNA.

Source:
NCBI, updated 2017-04-25
Taxon:
Mus musculus (mouse)
Gene:
Osgin1 (71839)
Length:
1982
CDS:
174..1610

Additional Resources:

NCBI RefSeq record:
NM_027950.1
NBCI Gene record:
Osgin1 (71839)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027950.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250986 TGCGTCCTGACACAGACTTTG pLKO_005 451 CDS 100% 10.800 15.120 N Osgin1 n/a
2 TRCN0000250984 CAGGAAGCCACCTTAACATTA pLKO_005 1595 CDS 100% 13.200 9.240 N Osgin1 n/a
3 TRCN0000258098 CAGGTGCTGACTTGGTCATAG pLKO_005 1399 CDS 100% 10.800 7.560 N Osgin1 n/a
4 TRCN0000250985 CCAGCTGCCCAAGATGCTATA pLKO_005 1157 CDS 100% 10.800 7.560 N Osgin1 n/a
5 TRCN0000189811 GACTTGGTCATAGACCCAGAT pLKO.1 1407 CDS 100% 4.050 2.835 N Osgin1 n/a
6 TRCN0000250983 TGAAGAGGAAGAGGGCTTATC pLKO_005 1641 3UTR 100% 10.800 6.480 N Osgin1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027950.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.