Transcript: Mouse NM_028099.4

Mus musculus dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) (Dusp11), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Dusp11 (72102)
Length:
6445
CDS:
133..1098

Additional Resources:

NCBI RefSeq record:
NM_028099.4
NBCI Gene record:
Dusp11 (72102)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028099.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314765 CTACCTCATTTGCAGATATTT pLKO_005 609 CDS 100% 15.000 21.000 N DUSP11 n/a
2 TRCN0000081479 CCCATACTACTGGGAATGGAA pLKO.1 1071 CDS 100% 3.000 4.200 N Dusp11 n/a
3 TRCN0000081480 CGCTATTATAAAGTAGAGGAT pLKO.1 421 CDS 100% 2.640 2.112 N Dusp11 n/a
4 TRCN0000081482 CCCTTTGGATCTGTTTAATAA pLKO.1 345 CDS 100% 15.000 10.500 N Dusp11 n/a
5 TRCN0000002928 GCTACCTCATTTGCAGATATT pLKO.1 608 CDS 100% 13.200 9.240 N DUSP11 n/a
6 TRCN0000081481 ACTCGTTTCATTGCTTTCAAA pLKO.1 271 CDS 100% 5.625 3.938 N Dusp11 n/a
7 TRCN0000002932 GACTCGTTTCATTGCTTTCAA pLKO.1 270 CDS 100% 5.625 3.938 N DUSP11 n/a
8 TRCN0000314810 GACTCGTTTCATTGCTTTCAA pLKO_005 270 CDS 100% 5.625 3.938 N DUSP11 n/a
9 TRCN0000081478 GCCCTTTGATTTGACTCCTTT pLKO.1 3042 3UTR 100% 4.950 3.465 N Dusp11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028099.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.