Transcript: Mouse NM_028122.4

Mus musculus solute carrier family 14 (urea transporter), member 1 (Slc14a1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Slc14a1 (108052)
Length:
3675
CDS:
207..1361

Additional Resources:

NCBI RefSeq record:
NM_028122.4
NBCI Gene record:
Slc14a1 (108052)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028122.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070361 CTTCTCAAACAAGGGCGACTA pLKO.1 596 CDS 100% 4.050 5.670 N Slc14a1 n/a
2 TRCN0000070358 CCCTGTATCTGCTATGTCTAT pLKO.1 635 CDS 100% 4.950 3.465 N Slc14a1 n/a
3 TRCN0000070360 GCCCGTCTTCACTCTCCCTTT pLKO.1 710 CDS 100% 1.350 0.945 N Slc14a1 n/a
4 TRCN0000070362 GCACACCTGATGGCTGTGGTT pLKO.1 1170 CDS 100% 0.880 0.616 N Slc14a1 n/a
5 TRCN0000070359 CTCCAGTTCATGGACTGGATA pLKO.1 357 CDS 100% 0.495 0.347 N Slc14a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028122.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.