Transcript: Mouse NM_028243.3

Mus musculus prolylcarboxypeptidase (angiotensinase C) (Prcp), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Prcp (72461)
Length:
2964
CDS:
87..1562

Additional Resources:

NCBI RefSeq record:
NM_028243.3
NBCI Gene record:
Prcp (72461)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028243.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000445173 GAAGATTGTAACTAACGATTT pLKO_005 737 CDS 100% 10.800 15.120 N Prcp n/a
2 TRCN0000092030 CCCGTAAATACTCAGTTCTTT pLKO.1 214 CDS 100% 5.625 7.875 N Prcp n/a
3 TRCN0000092031 CGAACATTCTTCACCTATGTA pLKO.1 853 CDS 100% 5.625 7.875 N Prcp n/a
4 TRCN0000092029 GCCCGTAAATACTCAGTTCTT pLKO.1 213 CDS 100% 4.950 6.930 N Prcp n/a
5 TRCN0000447707 TTCCAAGCTCTGAGTGTATAT pLKO_005 1062 CDS 100% 13.200 10.560 N Prcp n/a
6 TRCN0000450236 AGCAATATCCAATGAACAATT pLKO_005 1548 CDS 100% 13.200 9.240 N Prcp n/a
7 TRCN0000442576 AGTCTCTCTGGCCCATTGTAA pLKO_005 1881 3UTR 100% 5.625 3.938 N Prcp n/a
8 TRCN0000092032 GCAGAGAAATGGTGGATCAAT pLKO.1 317 CDS 100% 5.625 3.938 N Prcp n/a
9 TRCN0000092028 GCCTCACTGTCTTTGTGTCAT pLKO.1 1753 3UTR 100% 4.950 3.465 N Prcp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028243.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.