Transcript: Mouse NM_028259.4

Mus musculus ribosomal protein S6 kinase, polypeptide 1 (Rps6kb1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Rps6kb1 (72508)
Length:
3283
CDS:
102..1052

Additional Resources:

NCBI RefSeq record:
NM_028259.4
NBCI Gene record:
Rps6kb1 (72508)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028259.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022904 GCATGGAACATTGTGAGAAAT pLKO.1 295 CDS 100% 13.200 10.560 N Rps6kb1 n/a
2 TRCN0000297869 GCATGGAACATTGTGAGAAAT pLKO_005 295 CDS 100% 13.200 10.560 N Rps6kb1 n/a
3 TRCN0000022906 GCAGTCTTAGGGAGGTGATAA pLKO.1 751 CDS 100% 13.200 9.240 N Rps6kb1 n/a
4 TRCN0000350402 TTTGCCATGAAGGTGCTTAAA pLKO_005 459 CDS 100% 13.200 9.240 N RPS6KB1 n/a
5 TRCN0000022908 ACATTGTTACACAGCCAGTAT pLKO.1 994 CDS 100% 4.950 3.465 N Rps6kb1 n/a
6 TRCN0000280574 ACATTGTTACACAGCCAGTAT pLKO_005 994 CDS 100% 4.950 3.465 N Rps6kb1 n/a
7 TRCN0000003161 TATTTGCCATGAAGGTGCTTA pLKO.1 457 CDS 100% 4.950 3.465 N RPS6KB1 n/a
8 TRCN0000022905 CCCTTTCATTGTGGACCTGAT pLKO.1 557 CDS 100% 4.050 2.835 N Rps6kb1 n/a
9 TRCN0000280514 CCCTTTCATTGTGGACCTGAT pLKO_005 557 CDS 100% 4.050 2.835 N Rps6kb1 n/a
10 TRCN0000022907 GCAGTTAGAAAGAGAGGGAAT pLKO.1 647 CDS 100% 4.050 2.430 N Rps6kb1 n/a
11 TRCN0000280573 GCAGTTAGAAAGAGAGGGAAT pLKO_005 647 CDS 100% 4.050 2.430 N Rps6kb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028259.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.