Transcript: Mouse NM_028308.2

Mus musculus MOB kinase activator 2 (Mob2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Mob2 (101513)
Length:
1456
CDS:
34..741

Additional Resources:

NCBI RefSeq record:
NM_028308.2
NBCI Gene record:
Mob2 (101513)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028308.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125838 GTATAGCACAATCTCAGAATT pLKO.1 243 CDS 100% 0.000 0.000 N Mob2 n/a
2 TRCN0000312350 GTATAGCACAATCTCAGAATT pLKO_005 243 CDS 100% 0.000 0.000 N Mob2 n/a
3 TRCN0000125837 GCAGTATAGCACAATCTCAGA pLKO.1 240 CDS 100% 2.640 2.112 N Mob2 n/a
4 TRCN0000313314 AGATCTGCAAGTATCTGTTTC pLKO_005 470 CDS 100% 10.800 7.560 N Mob2 n/a
5 TRCN0000313383 AGCCTTTGGAGTCATTCATTC pLKO_005 938 3UTR 100% 10.800 7.560 N Mob2 n/a
6 TRCN0000313313 CTAAGCCAAACGGCAAGAAAC pLKO_005 62 CDS 100% 10.800 7.560 N Mob2 n/a
7 TRCN0000313384 GAACACACTGTACGTGCATTT pLKO_005 558 CDS 100% 10.800 7.560 N Mob2 n/a
8 TRCN0000125835 CCAGGATCACTGACTTTGAAT pLKO.1 131 CDS 100% 5.625 3.938 N Mob2 n/a
9 TRCN0000125836 GCTAAGCCAAACGGCAAGAAA pLKO.1 61 CDS 100% 5.625 3.938 N Mob2 n/a
10 TRCN0000125834 CGGCTTTGAAAGGAGCACCTT pLKO.1 1075 3UTR 100% 2.640 1.848 N Mob2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028308.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09065 pDONR223 100% 87.3% 91.9% None (many diffs) n/a
Download CSV