Transcript: Mouse NM_028354.4

Mus musculus tyrosyl-DNA phosphodiesterase 1 (Tdp1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Tdp1 (104884)
Length:
2073
CDS:
46..1875

Additional Resources:

NCBI RefSeq record:
NM_028354.4
NBCI Gene record:
Tdp1 (104884)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028354.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257087 CAGTTATCTAACGGCGTATAA pLKO_005 1020 CDS 100% 13.200 18.480 N Tdp1 n/a
2 TRCN0000189478 CGAAGCCCTATGCGAACATTT pLKO.1 773 CDS 100% 13.200 10.560 N Tdp1 n/a
3 TRCN0000257079 CGAAGCCCTATGCGAACATTT pLKO_005 773 CDS 100% 13.200 10.560 N Tdp1 n/a
4 TRCN0000241961 CCTGCTTGTGCACGGTGATAA pLKO_005 720 CDS 100% 13.200 9.240 N Tdp1 n/a
5 TRCN0000257051 TAAAGTCCTGCACCCGTACAG pLKO_005 1900 3UTR 100% 4.050 2.835 N Tdp1 n/a
6 TRCN0000241962 GTGTCGAAGGAGCTCATATAC pLKO_005 163 CDS 100% 13.200 7.920 N Tdp1 n/a
7 TRCN0000200957 CCCAGAAAGTTGTGGATAGAA pLKO.1 419 CDS 100% 5.625 3.375 N Tdp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028354.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.