Transcript: Mouse NM_028679.3

Mus musculus interleukin-1 receptor-associated kinase 3 (Irak3), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Irak3 (73914)
Length:
2969
CDS:
79..1908

Additional Resources:

NCBI RefSeq record:
NM_028679.3
NBCI Gene record:
Irak3 (73914)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028679.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361869 CACGTTCGAATCAGCGTATTG pLKO_005 910 CDS 100% 10.800 15.120 N Irak3 n/a
2 TRCN0000022457 CCAACCCAAACTAACGGATTT pLKO.1 1032 CDS 100% 10.800 15.120 N Irak3 n/a
3 TRCN0000022454 GCAGAGTTCTACCATAAATAT pLKO.1 1086 CDS 100% 15.000 10.500 N Irak3 n/a
4 TRCN0000368750 CTGGCTGGATGTTCGTCATAT pLKO_005 231 CDS 100% 13.200 9.240 N Irak3 n/a
5 TRCN0000361868 TCAACGAGCTATCCACTTAAT pLKO_005 363 CDS 100% 13.200 9.240 N Irak3 n/a
6 TRCN0000022458 CCAAGTATTCCAGTAGAAGAT pLKO.1 1540 CDS 100% 4.950 3.465 N Irak3 n/a
7 TRCN0000022455 CCCTATCAGCTTCCAGAGTAT pLKO.1 570 CDS 100% 4.950 3.465 N Irak3 n/a
8 TRCN0000022456 GCAACTAAAGAAGCACTGGAA pLKO.1 717 CDS 100% 2.640 1.848 N Irak3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028679.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.