Transcript: Mouse NM_028732.4

Mus musculus V-set immunoregulatory receptor (Vsir), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Vsir (74048)
Length:
4846
CDS:
172..1101

Additional Resources:

NCBI RefSeq record:
NM_028732.4
NBCI Gene record:
Vsir (74048)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028732.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438227 TCCACATGCATGGCGTCTAAT pLKO_005 694 CDS 100% 13.200 18.480 N Vsir n/a
2 TRCN0000437885 GAACCCTGCTCCTTGCTATTT pLKO_005 215 CDS 100% 13.200 9.240 N Vsir n/a
3 TRCN0000445998 CCCATACGCAACTTCACATTG pLKO_005 433 CDS 100% 10.800 7.560 N Vsir n/a
4 TRCN0000425090 GATATGTGCACTTGATCTATG pLKO_005 1141 3UTR 100% 10.800 7.560 N Vsir n/a
5 TRCN0000126006 CCACCACGGTAACTTCTCTAT pLKO.1 540 CDS 100% 4.950 3.465 N Vsir n/a
6 TRCN0000126008 CCCTAACTCTGAAGCCATCTA pLKO.1 1080 CDS 100% 4.950 3.465 N Vsir n/a
7 TRCN0000126007 GCAACACCCAAGGAATCGAAA pLKO.1 869 CDS 100% 4.950 3.465 N Vsir n/a
8 TRCN0000126005 GCACGATGTGACCATCTACAA pLKO.1 360 CDS 100% 4.950 3.465 N Vsir n/a
9 TRCN0000126004 GCAGTATGAATGCCATGTCTT pLKO.1 4422 3UTR 100% 4.950 3.465 N Vsir n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028732.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.