Transcript: Mouse NM_028762.1

Mus musculus RNA binding motif protein 19 (Rbm19), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Rbm19 (74111)
Length:
4008
CDS:
102..2960

Additional Resources:

NCBI RefSeq record:
NM_028762.1
NBCI Gene record:
Rbm19 (74111)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028762.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124741 GCCTATTCTAAGTTCCACCAT pLKO.1 2019 CDS 100% 2.640 3.696 N Rbm19 n/a
2 TRCN0000124740 GCCATCCGAATAGTGAGAAAT pLKO.1 1059 CDS 100% 13.200 10.560 N Rbm19 n/a
3 TRCN0000124743 ACGCTGTTTATGGGACCAAAT pLKO.1 1638 CDS 100% 10.800 8.640 N Rbm19 n/a
4 TRCN0000124739 CCAACTTTATGTGAGAGTCTT pLKO.1 3811 3UTR 100% 4.950 3.465 N Rbm19 n/a
5 TRCN0000124742 GCTGTCAGACATGGACTACTT pLKO.1 722 CDS 100% 4.950 3.465 N Rbm19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028762.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.