Transcript: Mouse NM_028790.3

Mus musculus acyl-CoA thioesterase 12 (Acot12), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Acot12 (74156)
Length:
3049
CDS:
11..1681

Additional Resources:

NCBI RefSeq record:
NM_028790.3
NBCI Gene record:
Acot12 (74156)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028790.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247885 AGCGAGGACGATCAGATATAT pLKO_005 1301 CDS 100% 15.000 21.000 N Acot12 n/a
2 TRCN0000247886 TACGATATCACATGATCTATA pLKO_005 1891 3UTR 100% 13.200 10.560 N Acot12 n/a
3 TRCN0000257796 CAGCGAGAATTGGACAAATTA pLKO_005 204 CDS 100% 15.000 10.500 N Acot12 n/a
4 TRCN0000247884 CCTTACTTTGCTGGCAATATT pLKO_005 1568 CDS 100% 15.000 10.500 N Acot12 n/a
5 TRCN0000247883 TCAGTGCACAGTGGGATATAA pLKO_005 1029 CDS 100% 15.000 10.500 N Acot12 n/a
6 TRCN0000182891 CCATATCTGTTAAGGTTGAAA pLKO.1 1173 CDS 100% 5.625 3.938 N Acot12 n/a
7 TRCN0000183700 GAGATCAGTATCAAGGTCATA pLKO.1 269 CDS 100% 4.950 3.465 N Acot12 n/a
8 TRCN0000048727 CCACAGTACATCAGAAGTGAA pLKO.1 1460 CDS 100% 4.950 3.465 N ACOT12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028790.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.