Transcript: Mouse NM_028805.2

Mus musculus katanin p80 (WD40-containing) subunit B 1 (Katnb1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Katnb1 (74187)
Length:
3425
CDS:
361..2337

Additional Resources:

NCBI RefSeq record:
NM_028805.2
NBCI Gene record:
Katnb1 (74187)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028805.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000346838 AGTCAACCTGTGGTCCATAAA pLKO_005 492 CDS 100% 13.200 18.480 N Katnb1 n/a
2 TRCN0000091093 GCTGTAAATTATCAGGCAGAT pLKO.1 2565 3UTR 100% 4.050 5.670 N Katnb1 n/a
3 TRCN0000091095 CCAATGAATATCTCCTAGCTT pLKO.1 956 CDS 100% 3.000 4.200 N Katnb1 n/a
4 TRCN0000091097 GCAGAGCAAGTATGAGAGCTA pLKO.1 2070 CDS 100% 2.640 3.696 N Katnb1 n/a
5 TRCN0000346780 AGGCTGTGTCTTCCGATATAG pLKO_005 771 CDS 100% 13.200 9.240 N Katnb1 n/a
6 TRCN0000346837 AGCAAGCCTCAGAGGGTAAAG pLKO_005 1393 CDS 100% 10.800 7.560 N Katnb1 n/a
7 TRCN0000346839 AGGATGCCATGTCGCAGATAC pLKO_005 1823 CDS 100% 10.800 7.560 N Katnb1 n/a
8 TRCN0000091096 CCAGAGTAATGTCTCCTCTTA pLKO.1 1233 CDS 100% 4.950 3.465 N Katnb1 n/a
9 TRCN0000091094 GCGGAGGACTACAATGAGATT pLKO.1 1495 CDS 100% 4.950 3.465 N Katnb1 n/a
10 TRCN0000346778 TGTAAATTATCAGGCAGATTT pLKO_005 2567 3UTR 100% 13.200 7.920 N Katnb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028805.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07584 pDONR223 99.2% 88.8% 95.1% None (many diffs) n/a
2 ccsbBroad304_07584 pLX_304 0% 88.8% 95.1% V5 (many diffs) n/a
Download CSV