Transcript: Mouse NM_028809.1

Mus musculus actin related protein 2/3 complex, subunit 5-like (Arpc5l), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Arpc5l (74192)
Length:
1271
CDS:
58..519

Additional Resources:

NCBI RefSeq record:
NM_028809.1
NBCI Gene record:
Arpc5l (74192)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028809.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100312 CGCGTGGATATCGACGAATTT pLKO.1 91 CDS 100% 13.200 18.480 N Arpc5l n/a
2 TRCN0000100313 CAAACTTTAAGAGCAGCGAAA pLKO.1 314 CDS 100% 4.050 5.670 N Arpc5l n/a
3 TRCN0000446300 GGTGTAGTCCTGAAAGTACTC pLKO_005 292 CDS 100% 4.050 3.240 N Arpc5l n/a
4 TRCN0000100310 CGGTGTGTTCTCTGTATGTTA pLKO.1 997 3UTR 100% 5.625 3.938 N Arpc5l n/a
5 TRCN0000100311 GCTCCATTATAAGAGTTCTTA pLKO.1 479 CDS 100% 5.625 3.938 N Arpc5l n/a
6 TRCN0000146953 CTTACAGCAAGAAAGACTGTT pLKO.1 496 CDS 100% 4.950 3.465 N ARPC5L n/a
7 TRCN0000100314 GAAATGGCATTGATTTGCTAA pLKO.1 362 CDS 100% 4.950 2.970 N Arpc5l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028809.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.