Transcript: Mouse NM_028852.1

Mus musculus spermatogenesis and centriole associated 1 (Spatc1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Spatc1 (74281)
Length:
1621
CDS:
84..1526

Additional Resources:

NCBI RefSeq record:
NM_028852.1
NBCI Gene record:
Spatc1 (74281)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028852.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201412 CAGTCAAATGACTAGTCCCAT pLKO.1 599 CDS 100% 0.000 0.000 N Spatc1 n/a
2 TRCN0000181048 CTCCAACATCCCAGAGAAGAT pLKO.1 1169 CDS 100% 4.950 3.465 N SPATC1 n/a
3 TRCN0000202306 GATGGAACAGTCTCGGAAGAA pLKO.1 971 CDS 100% 4.950 3.465 N Spatc1 n/a
4 TRCN0000202487 GTCTGGCCAAATACCCTTGTT pLKO.1 452 CDS 100% 4.950 3.465 N Spatc1 n/a
5 TRCN0000202291 GCAACCAACTGACCAATCCTA pLKO.1 514 CDS 100% 3.000 2.100 N Spatc1 n/a
6 TRCN0000180126 CAGAGAAGATCATCCAGGCTT pLKO.1 1180 CDS 100% 2.640 1.848 N SPATC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028852.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.