Transcript: Mouse NM_028890.2

Mus musculus RIKEN cDNA 4931414P19 gene (4931414P19Rik), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
4931414P19Rik (74359)
Length:
2585
CDS:
342..1967

Additional Resources:

NCBI RefSeq record:
NM_028890.2
NBCI Gene record:
4931414P19Rik (74359)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028890.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191455 CCTGACTTGAACTCGTTTATT pLKO.1 1911 CDS 100% 15.000 21.000 N 4931414P19Rik n/a
2 TRCN0000200800 GCTTACCGCTATTTGGAATTA pLKO.1 2445 3UTR 100% 13.200 18.480 N 4931414P19Rik n/a
3 TRCN0000418950 AGAGGCGAGAGTACCGCAATT pLKO_005 1456 CDS 100% 10.800 15.120 N 4931414P19Rik n/a
4 TRCN0000433387 CAACCCTTTCAAAGGCCTAAA pLKO_005 1481 CDS 100% 10.800 15.120 N 4931414P19Rik n/a
5 TRCN0000419187 CCAATGACAAGAGATTCAATG pLKO_005 1294 CDS 100% 10.800 15.120 N 4931414P19Rik n/a
6 TRCN0000202126 CGCCAATCGATCCAGTATCAT pLKO.1 1547 CDS 100% 5.625 7.875 N 4931414P19Rik n/a
7 TRCN0000190215 CCACCTGGATGCTAACTCTAA pLKO.1 1715 CDS 100% 4.950 6.930 N 4931414P19Rik n/a
8 TRCN0000189581 CCACAGCTCAGGAGAAACATT pLKO.1 2317 3UTR 100% 5.625 3.938 N 4931414P19Rik n/a
9 TRCN0000202488 GCAATGAGAAAGGACCTGTCT pLKO.1 1855 CDS 100% 2.640 1.848 N 4931414P19Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028890.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14240 pDONR223 100% 77% 79.1% None (many diffs) n/a
2 ccsbBroad304_14240 pLX_304 0% 77% 79.1% V5 (many diffs) n/a
Download CSV