Transcript: Mouse NM_028892.4

Mus musculus sperm associated antigen 17 (Spag17), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Spag17 (74362)
Length:
7862
CDS:
76..7038

Additional Resources:

NCBI RefSeq record:
NM_028892.4
NBCI Gene record:
Spag17 (74362)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028892.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247448 TCCGAATTGAGCTCGTTATTT pLKO_005 5872 CDS 100% 15.000 21.000 N Spag17 n/a
2 TRCN0000247449 TGTCAATTTACCGTTACATTA pLKO_005 363 CDS 100% 13.200 18.480 N Spag17 n/a
3 TRCN0000184708 CGCCACTATTCACGAGCTTAT pLKO.1 1800 CDS 100% 10.800 15.120 N Spag17 n/a
4 TRCN0000167306 CGATAAGTTACTATGGATCAA pLKO.1 3524 CDS 100% 4.950 6.930 N SPAG17 n/a
5 TRCN0000247447 ATTTCCCTTAAGGACTATATA pLKO_005 5482 CDS 100% 15.000 10.500 N Spag17 n/a
6 TRCN0000247450 GTAGCCTGAATCGGCTTAATA pLKO_005 7158 3UTR 100% 15.000 10.500 N Spag17 n/a
7 TRCN0000247451 TGGACTGAAAGTGACATATAA pLKO_005 6723 CDS 100% 15.000 10.500 N Spag17 n/a
8 TRCN0000216190 CATCTCCCACAATATCGAAAT pLKO.1 6837 CDS 100% 10.800 7.560 N Spag17 n/a
9 TRCN0000183315 GAGAACACTATTTGTGAACAA pLKO.1 2085 CDS 100% 4.950 3.465 N Spag17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028892.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.