Transcript: Mouse NM_028938.2

Mus musculus leucine-rich repeats and IQ motif containing 3 (Lrriq3), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Lrriq3 (74435)
Length:
2650
CDS:
238..2139

Additional Resources:

NCBI RefSeq record:
NM_028938.2
NBCI Gene record:
Lrriq3 (74435)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028938.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109643 CCAGTCTATTCTTTAACCTTT pLKO.1 773 CDS 100% 4.950 6.930 N Lrriq3 n/a
2 TRCN0000109641 CGTGGTTTCATAGTTAGGAAA pLKO.1 916 CDS 100% 4.950 6.930 N Lrriq3 n/a
3 TRCN0000109642 CCCAGTCTATTCTTTAACCTT pLKO.1 772 CDS 100% 3.000 4.200 N Lrriq3 n/a
4 TRCN0000378508 GAGGAATGGAGTCACTATAAT pLKO_005 277 CDS 100% 15.000 10.500 N Lrriq3 n/a
5 TRCN0000362916 GCGTCTTCCAGAGAGGTTTAA pLKO_005 741 CDS 100% 13.200 9.240 N Lrriq3 n/a
6 TRCN0000362917 TCAAGCCTGAATGCAACATAA pLKO_005 1061 CDS 100% 13.200 9.240 N Lrriq3 n/a
7 TRCN0000109644 CCACAATACCTCCAGCCATTT pLKO.1 1378 CDS 100% 10.800 7.560 N Lrriq3 n/a
8 TRCN0000109640 GCAGGATTTGTTGATGGAAAT pLKO.1 1932 CDS 100% 10.800 7.560 N Lrriq3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028938.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.