Transcript: Mouse NM_028999.1

Mus musculus protein phosphatase 6, regulatory subunit 3 (Ppp6r3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-04-17
Taxon:
Mus musculus (mouse)
Gene:
Ppp6r3 (52036)
Length:
4979
CDS:
264..2885

Additional Resources:

NCBI RefSeq record:
NM_028999.1
NBCI Gene record:
Ppp6r3 (52036)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028999.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240830 ATCCGATACAAGTATCCAAAT pLKO_005 480 CDS 100% 10.800 15.120 N Ppp6r3 n/a
2 TRCN0000240828 AGTATCACTGATGGCTATTTC pLKO_005 3744 3UTR 100% 13.200 9.240 N Ppp6r3 n/a
3 TRCN0000240826 GATGTTCTGAATTGGCTAAAT pLKO_005 804 CDS 100% 13.200 9.240 N Ppp6r3 n/a
4 TRCN0000240829 TGAACAGCATTGGCGTCATAT pLKO_005 1369 CDS 100% 13.200 9.240 N Ppp6r3 n/a
5 TRCN0000240827 TGATTATCAGATGCAACAAAT pLKO_005 1904 CDS 100% 13.200 9.240 N Ppp6r3 n/a
6 TRCN0000428345 TGATTATCAGATGCAACAAAT pLKO_005 1904 CDS 100% 13.200 9.240 N PPP6R3 n/a
7 TRCN0000191920 GCTACAACTTAGTTGATGAAT pLKO.1 3524 3UTR 100% 5.625 3.938 N Ppp6r3 n/a
8 TRCN0000200809 GCAAGCTCATAGAATTTCTGT pLKO.1 388 CDS 100% 3.000 2.100 N Ppp6r3 n/a
9 TRCN0000192655 GCCTCACAATCACTTTGTGAA pLKO.1 894 CDS 100% 0.495 0.347 N Ppp6r3 n/a
10 TRCN0000160381 CAAGGTGCTAAGTATTCTTAT pLKO.1 638 CDS 100% 13.200 7.920 N PPP6R3 n/a
11 TRCN0000161015 GAATACTTGAAGCCTGGGAAA pLKO.1 1570 CDS 100% 4.050 2.835 N PPP6R3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028999.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15896 pDONR223 0% 20% 20.8% None (many diffs) n/a
2 ccsbBroad304_15896 pLX_304 0% 20% 20.8% V5 (many diffs) n/a
Download CSV