Transcript: Mouse NM_029074.3

Mus musculus CTD nuclear envelope phosphatase 1 regulatory subunit 1 (Cnep1r1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Cnep1r1 (382030)
Length:
1832
CDS:
87..464

Additional Resources:

NCBI RefSeq record:
NM_029074.3
NBCI Gene record:
Cnep1r1 (382030)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029074.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196066 GCGCCTCAGTACCTTTGATTA pLKO.1 636 3UTR 100% 13.200 18.480 N Cnep1r1 n/a
2 TRCN0000245538 GCTCGATGTCGAACGGTATTA pLKO_005 375 CDS 100% 13.200 18.480 N CNEP1R1 n/a
3 TRCN0000253539 GCTCGATGTCGAACGGTATTA pLKO_005 375 CDS 100% 13.200 18.480 N Cnep1r1 n/a
4 TRCN0000183237 GCTGTATAACTCTAATAGGCT pLKO.1 304 CDS 100% 0.750 1.050 N Cnep1r1 n/a
5 TRCN0000253537 GTGCCTGGAACTGGCTAATAG pLKO_005 220 CDS 100% 13.200 10.560 N Cnep1r1 n/a
6 TRCN0000253538 TTAGCTGTATAACTCTAATAG pLKO_005 301 CDS 100% 13.200 10.560 N Cnep1r1 n/a
7 TRCN0000253540 CTCTACTTTCCTGGGTATAAA pLKO_005 1584 3UTR 100% 15.000 10.500 N Cnep1r1 n/a
8 TRCN0000215571 GATGATACAGGAAAGCTAATT pLKO.1 417 CDS 100% 13.200 9.240 N Cnep1r1 n/a
9 TRCN0000253541 GTGTCCTTCTTCACGTCATTA pLKO_005 258 CDS 100% 13.200 9.240 N Cnep1r1 n/a
10 TRCN0000167383 GAATGCTTCTTATAGTGGTAT pLKO.1 181 CDS 100% 4.950 3.465 N CNEP1R1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029074.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.