Transcript: Mouse NM_029231.4

Mus musculus proline, glutamic acid and leucine rich protein 1 (Pelp1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Pelp1 (75273)
Length:
3463
CDS:
20..3391

Additional Resources:

NCBI RefSeq record:
NM_029231.4
NBCI Gene record:
Pelp1 (75273)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029231.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177043 GCATTGGTGAATCTCAGTAAT pLKO.1 287 CDS 100% 13.200 10.560 N Pelp1 n/a
2 TRCN0000292849 GCATTGGTGAATCTCAGTAAT pLKO_005 287 CDS 100% 13.200 10.560 N Pelp1 n/a
3 TRCN0000176974 GAAGAGTTAGATGAGGTAGAA pLKO.1 2876 CDS 100% 4.950 3.465 N Pelp1 n/a
4 TRCN0000292790 GAAGAGTTAGATGAGGTAGAA pLKO_005 2876 CDS 100% 4.950 3.465 N Pelp1 n/a
5 TRCN0000198967 GCTCTGATGGAGGTTTGCAAA pLKO.1 1464 CDS 100% 4.950 3.465 N Pelp1 n/a
6 TRCN0000298055 GCTCTGATGGAGGTTTGCAAA pLKO_005 1464 CDS 100% 4.950 3.465 N Pelp1 n/a
7 TRCN0000178252 GCCATGGAAGAAGATTTGACA pLKO.1 2651 CDS 100% 3.000 2.100 N Pelp1 n/a
8 TRCN0000298052 GCCATGGAAGAAGATTTGACA pLKO_005 2651 CDS 100% 3.000 2.100 N Pelp1 n/a
9 TRCN0000144578 GAAGATGAGGAAGAAGAAGAA pLKO.1 2735 CDS 100% 4.950 2.475 Y PTMS n/a
10 TRCN0000087583 AGGAGGAAGAGGAAGAGGAAA pLKO.1 2706 CDS 100% 4.950 2.475 Y Adam32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029231.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.